HUGE |
Gene/Protein Characteristic Table for KIAA0437 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00076 |
---|---|
Accession No. : | AB007897 |
Description : | SET-binding protein. |
HUGO Gene Name : | SET binding protein 1 (SETBP1) |
Clone Name : | hj00203s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0437
![]() |
Source : | Human adult brain |
Note : | We replaced hj00203, former representative clones for KIAA0437 with hj00203s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6197 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1110 bp Genome contig ID gi51511735f_40414861 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATCTTTTTCATTCAAATAATTGTCATAGGTTGTTCFlanking genome sequence
(483912 - 483961) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGGAAACAAAAACACAATAGAAGTCCATTATCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 40514861 40898771 6 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1605 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TCCTTTGCCCATTGTACTTCC | |
: ATAGCCTGGTTGACATCTGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: TCCTTTGCCCATTGTACTTCC | |
: ATAGCCTGGTTGACATCTGGG | |
: 254 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |