HUGE

Gene/Protein Characteristic Table for KIAA0437

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00076
Accession No. :	AB007897
Description :	SET-binding protein.
HUGO Gene Name :	SET binding protein 1 (SETBP1)
Clone Name :	hj00203s1 [Vector Info]
Flexi ORF Clone :	pF1KA0437
Source :	Human adult brain
Note :	We replaced hj00203, former representative clones for KIAA0437 with hj00203s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1110 bp

Genome contig ID gi51511735f_40414861
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATCTTTTTCATTCAAATAATTGTCATAGGTTGTTC
Flanking genome sequence
(483912 - 483961)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGGAAACAAAAACACAATAGAAGTCCATTATCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 40514861 40898771 6 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01441	100.0	SET binding pro...	Homo sapiens
NP_056374	99.9	SET binding pro...	Homo sapiens
XP_512106	99.7	SET binding pro...	Pan troglodytes
Q9Y6X0	100.0	SET-binding pro...	Homo sapiens
XP_001497935	95.5	similar to SET ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037841	7.4e-15	32.1	KIAA1420

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000637 593 605 PF02178 HMG-I and HMG-Y

IPR000637 1025 1037 PF02178 HMG-I and HMG-Y

IPR000637 1460 1472 PF02178 HMG-I and HMG-Y

HMMSmart IPR000637 593 605 SM00384 HMG-I and HMG-Y

IPR000637 1025 1037 SM00384 HMG-I and HMG-Y

IPR000637 1460 1472 SM00384 HMG-I and HMG-Y

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	593	605	PF02178	HMG-I and HMG-Y
IPR000637	1025	1037	PF02178	HMG-I and HMG-Y
IPR000637	1460	1472	PF02178	HMG-I and HMG-Y
HMMSmart	IPR000637	593	605	SM00384	HMG-I and HMG-Y
IPR000637	1025	1037	SM00384	HMG-I and HMG-Y
IPR000637	1460	1472	SM00384	HMG-I and HMG-Y

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCCTTTGCCCATTGTACTTCC

Primer_r
: ATAGCCTGGTTGACATCTGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCTTTGCCCATTGTACTTCC
Primer_r	: ATAGCCTGGTTGACATCTGGG
PCR product length	: 254 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1110 bp
Genome contig ID	gi51511735f_40414861
PolyA signal sequence (None)	+--------+--------+----*----+---- ATCTTTTTCATTCAAATAATTGTCATAGGTTGTTC
Flanking genome sequence (483912 - 483961)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGGAAACAAAAACACAATAGAAGTCCATTATCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	40514861	40898771	6	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0437

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information