| HUGE |
Gene/Protein Characteristic Table for KIAA0446 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00539 |
|---|---|
| Accession No. : | AB007915 |
| Description : | Solute carrier family 25 member 44. |
| HUGO Gene Name : | solute carrier family 25, member 44 (SLC25A44) |
| Clone Name : | fk03072 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0446
|
| Source : | Human fetal brain |
| Note : | We replaced hg00104, former representative clones for KIAA0446 with fk03072. (1999/12/23) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3461 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2360 bp Genome contig ID gi89161185f_154330544 PolyA signal sequence
(ATTAAA,-25)
CTGAAATGTAATTAAAAGTTTTTATTGAGCCCCCGFlanking genome sequence
(118668 - 118717)
AGCTTTGGCTTGCGCGTATTTTTCCGGTCGCGGACATCCCACCGCGCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 154430544 154449210 4 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 351 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : GAGAGTCTGCCTTTTCATTCC | |
| : ACTTCCATTCTCCCTAAACTG | |
| : 117 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
