HUGE |
Gene/Protein Characteristic Table for KIAA0447 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00079 |
---|---|
Accession No. : | AB007916 |
Description : | SLC35E2 protein. |
HUGO Gene Name : | solute carrier family 35, member E2 (SLC35E2) |
Clone Name : | fh17910 [Vector Info] |
Flexi ORF Clone : | pF1KA0447
![]() |
Source : | Human fetal brain |
Note : | We replaced hg00132, former representative clones for KIAA0447 with fh17910. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5272 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3613 bp Genome contig ID gi89161185r_1482803 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATGTTAAATATGGAAAAAAAAAAAAAAAAAAAAACFlanking genome sequence
(165882 - 165833) ----+----*----+----*----+----*----+----*----+----*
ACTGCTTTGTTTTCTTCCTTGTGGACCTCTGGTGTTCATGCTACTTTGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 1509475 1614041 11 98.7 Terminal No-hit ContigView(URL based/DAS) 1 r 1640910 1667316 8 98.5 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 466 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: ACTTACCACCACAGCAGAATC | |
: GTTTTGCATGTGACCTATTTC | |
: 106 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |