HUGE

Gene/Protein Characteristic Table for KIAA0452

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04348
Accession No. :	AB007921
Description :	TPR repeat-containing protein C1orf34.
HUGO Gene Name :	tetratricopeptide repeat domain 39A (TTC39A)
Clone Name :	hg00323 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6256 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4893 bp

Genome contig ID gi89161185r_51435779
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCTTAGCCTGGGCGACAGAGCGAGACCACATC
Flanking genome sequence
(99712 - 99663)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGATGGGACCGGGAACAGATTTCAGGGAGGGAGACTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 51535491 51569587 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06825	1.1e-153	98.2	hCG40295, isofo...	Homo sapiens
CAI13138	1.1e-153	98.2	tetratricopepti...	Homo sapiens
CAI13136	9.2e-130	97.0	tetratricopepti...	Homo sapiens
Q5SRH9	1.2e-129	99.1	Tetratricopepti...	Homo sapiens
AAH28374	2.2e-129	93.1	TTC39A protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGTGGACATTTGGGGAGCG
Primer_r	: GAATCCATCCCTCCTGAATCC
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4893 bp
Genome contig ID	gi89161185r_51435779
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTTAGCCTGGGCGACAGAGCGAGACCACATC
Flanking genome sequence (99712 - 99663)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGATGGGACCGGGAACAGATTTCAGGGAGGGAGACTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	51535491	51569587	11	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0452

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information