HUGE |
Gene/Protein Characteristic Table for KIAA0455 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00080 |
---|---|
Accession No. : | AB007924 |
Description : | plasticity related gene 1. |
HUGO Gene Name : | |
Clone Name : | fh02485 [Vector Info] |
Flexi ORF Clone : | pF1KA0455 |
Source : | Human fetal brain |
Note : | We replaced hg00513, former representative clones for KIAA0455 with fh02485. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5014 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2568 bp Genome contig ID gi89161185f_99402440 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TAAAATCATAGAAATAAAGATTAGATTTCTTCATCFlanking genome sequence
(145286 - 145335) ----+----*----+----*----+----*----+----*----+----*
AAAATTGGAATAGTTTGGTTTTTACTTCAGAGTCTGAATAGATAATAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 99502440 99547724 7 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 814 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: ATCAGTAAAGCACAGCCTAAC | |
: AGGTGGTATCTCTTCTTAGTG | |
: 83 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |