HUGE |
Gene/Protein Characteristic Table for KIAA0460 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05602 |
---|---|
Accession No. : | AB007929 |
Description : | |
HUGO Gene Name : | |
Clone Name : | bj00064 [Vector Info] |
Flexi ORF Clone : | pF1KA0460
![]() |
Source : | Human adult brain |
Note : | We replaced hg00776, former representative clones for KIAA0460 with bj00064. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4581 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 222 bp Genome contig ID gi89161185f_148503842 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTGCACTTATCTACCTTCCCCAAGTTGTTTGTATTFlanking genome sequence
(208816 - 208865) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAGTAAAGAAACACAACCAAAGCCATTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 148603842 148712656 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1452 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GTAGATAAGTGCAATGGGAGG | |
: ACATTGGAAGTAGGAGTTTGG | |
: 163 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |