HUGE |
Gene/Protein Characteristic Table for KIAA0466 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00543 |
---|---|
Accession No. : | AB007935 |
Description : | immunoglobulin superfamily, member 3 isoform 2. |
HUGO Gene Name : | |
Clone Name : | pg00625 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0466
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hg01451, former representative clones for KIAA0466 with pg00625. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6588 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2903 bp Genome contig ID gi89161185r_116818554 PolyA signal sequence
(AGTAAA,-19) +----*----+----*----+----*----+----
CACTTCAGAGACCTGTAGTAAATTATGTTGAAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACGGCTGTTTACATTTACTGCAGTCTTCTATCCTTCTTTCCCCTTACTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 116918554 117010571 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1214 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: ACTTGCTACAGAAACACCCGG | |
: CGGAGGAAAACTGCTGAATAC | |
: 136 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |