HUGE |
Gene/Protein Characteristic Table for KIAA0468 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK06744 |
---|---|
Accession No. : | AB007937 |
Description : | Syndecan-3. |
HUGO Gene Name : | |
Clone Name : | hg01596 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6400 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3742 bp Genome contig ID gi89161185r_31014901 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CCATTTATAAGAGGAAATAAAATTAAGCTGAAATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATGTGCCGTGTCCAGAGTATGAGATAAATATGGTCATTTGGGGAGGGCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 31114901 31124176 3 99.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 410 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GGGCTCTGGGGATGATGACTC | |
: CCCGTGGGCTTCTCAGAGTTG | |
: 149 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |