HUGE

Gene/Protein Characteristic Table for KIAA0471

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00083
Accession No. :	AB007940
Description :	RAB GTPase activating protein 1-like isoform A.
HUGO Gene Name :	RAB GTPase activating protein 1-like (RABGAP1L)
Clone Name :	hg03220 [Vector Info]
Flexi ORF Clone :	pF1KA0471
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5309 bp

Genome contig ID gi89161185f_172935741
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCATTAAGCAGTAATAAACATTTGTTCTGAAGTCC
Flanking genome sequence
(295328 - 295377)
----+----*----+----*----+----*----+----*----+----*
ATGTATGTCTTTTTTATTTTTTTAGTTGACTTTATTCTGACTCATTTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 173035658 173231067 10 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 413 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI16277	1.4e-117	100.0	RAB GTPase acti...	Homo sapiens
AAI49458	1.3e-114	97.8	MGC157043 prote...	Bos taurus
BAE28037	2.8e-113	96.2	unnamed protein...	Mus musculus
BAA77334	1.1e-97	99.7	IDN4-GGTR9 [Hom...	Homo sapiens
BAA77330	1.1e-97	99.7	IDN4-GGTR6 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGCTCACAAAAACAGTCACC
Primer_r	: ATGACCAATTAGACGTTTCCG
PCR product length	: 236 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5309 bp
Genome contig ID	gi89161185f_172935741
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCATTAAGCAGTAATAAACATTTGTTCTGAAGTCC
Flanking genome sequence (295328 - 295377)	----+--------+--------+--------+--------+----* ATGTATGTCTTTTTTATTTTTTTAGTTGACTTTATTCTGACTCATTTGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	173035658	173231067	10	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0471

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information