HUGE |
Gene/Protein Characteristic Table for KIAA0473 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00085 |
---|---|
Accession No. : | AB007942 |
Description : | Putative tyrosine-protein phosphatase auxilin. |
HUGO Gene Name : | DnaJ (Hsp40) homolog, subfamily C, member 6 (DNAJC6) |
Clone Name : | hh00220 [Vector Info] |
Flexi ORF Clone : | pF1KA0473
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5747 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2848 bp Genome contig ID gi89161185f_65403025 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
GCTAAAATAAATGTAGCATCTAATTTTATCAGTTTFlanking genome sequence
(251117 - 251166) ----+----*----+----*----+----*----+----*----+----*
AACATCTGATATGTCTTCTATCCATGTACAATATTTTAAATGGATTTTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 65503025 65654140 19 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 937 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: TTGCTCATTCCCTACACAGAC | |
: GATTGAACCTGGAAGTCTGGG | |
: 183 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |