HUGE

Gene/Protein Characteristic Table for KIAA0483

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04999
Accession No. :	AB007952
Description :	F-box only protein 28.
HUGO Gene Name :	F-box protein 28 (FBXO28)
Clone Name :	hj00879 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5201 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4300 bp

Genome contig ID gi89161185f_222268661
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAACAGGGTACGTAAATAAATGTGTTGTTACCAGT
Flanking genome sequence
(147712 - 147761)
----+----*----+----*----+----*----+----*----+----*
GCTACTTGTTTTCTTTGTATTTCATGCACAAAAGAATATGGAGCTCTATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 222368661 222416371 5 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 299 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NVF7	7.7e-100	100.0	F-box only prot...	Homo sapiens
XP_001097187	7.7e-100	100.0	similar to F-bo...	Macaca mulatta
XP_001915239	3.2e-99	99.3	similar to F-bo...	Equus caballus
Q2NL16	3.2e-99	99.3	F-box only prot...	Bos taurus
EDL94872	6.2e-99	99.0	F-box protein 2...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTACGTACCCTGTTGTGTGAC
Primer_r	: CCTTTATTGTGGTACCATGTC
PCR product length	: 144 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4300 bp
Genome contig ID	gi89161185f_222268661
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAACAGGGTACGTAAATAAATGTGTTGTTACCAGT
Flanking genome sequence (147712 - 147761)	----+--------+--------+--------+--------+----* GCTACTTGTTTTCTTTGTATTTCATGCACAAAAGAATATGGAGCTCTATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	222368661	222416371	5	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0483

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information