HUGE

Gene/Protein Characteristic Table for KIAA0496

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04696
Accession No. :	AB007965
Description :	Cysteine/histidine-rich protein 1 (Fragment).
HUGO Gene Name :	cysteine/histidine-rich 1 (CYHR1)
Clone Name :	hg00144 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6151 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 546 bp

Genome contig ID gi51511724r_145547318
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTGTATCAGAACCAATAAAGTGCACTTGTTCTCGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCGCATCCTGTCTGTGTGTCTGCTTACCCCGCCCTGGGGGACACCCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 145647318 145654119 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD18724	6.5e-68	100.0	FLJ00352 protei...	Homo sapiens
XP_001714958	2.7e-64	100.0	hypothetical pr...	Homo sapiens
XP_001714266	2.9e-64	100.0	hypothetical pr...	Homo sapiens
EAW82090	3.4e-64	98.0	cysteine/histid...	Homo sapiens
XP_001092948	5.9e-64	97.4	similar to cyst...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001293 42 100 PS50145 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001293	42	100	PS50145	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGCAGTCCAGGTGTGAAAGG
Primer_r	: TAAAGGGGAGCTAGATGGGCG
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	546 bp
Genome contig ID	gi51511724r_145547318
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTGTATCAGAACCAATAAAGTGCACTTGTTCTCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCGCATCCTGTCTGTGTGTCTGCTTACCCCGCCCTGGGGGACACCCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	145647318	145654119	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0496

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information