HUGE

Gene/Protein Characteristic Table for KIAA0514

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05349
Accession No. :	AB011086
Description :	G protein-regulated inducer of neurite outgrowth 2.
HUGO Gene Name :
Clone Name :	hf00310 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7724 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 5387 bp

Genome contig ID gi89161187f_46317932
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCAGAAGAACACCTGAGGAAAGCTGATGTTTACT
Flanking genome sequence
(107719 - 107768)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAACAAGCGAAACCAAAGTGACGTGGGCCCATAGGATTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 46417932 46425649 1 98.0 Perfect prediction

Features of the protein sequence	Description

Length: 483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH11672	4.6e-163	100.0	GPRIN2 protein ...	Homo sapiens
O60269	2.1e-157	97.6	G protein-regul...	Homo sapiens
XP_001082938	2.3e-153	95.2	hypothetical pr...	Macaca mulatta
XP_001500796	1.5e-124	79.4	similar to GPRI...	Equus caballus
XP_592057	3.8e-117	76.8	similar to G pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTTATTATTCCCGTGTAGCC

Primer_r
: CTTCTTTAGGCTTGCTCACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTTATTATTCCCGTGTAGCC
Primer_r	: CTTCTTTAGGCTTGCTCACTC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	5387 bp
Genome contig ID	gi89161187f_46317932
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCAGAAGAACACCTGAGGAAAGCTGATGTTTACT
Flanking genome sequence (107719 - 107768)	----+--------+--------+--------+--------+----* AAAAAAAAAAACAAGCGAAACCAAAGTGACGTGGGCCCATAGGATTGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	46417932	46425649	1	98.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0514

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information