HUGE

Gene/Protein Characteristic Table for KIAA0518

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07635
Accession No. :	AB011090
Description :
HUGO Gene Name :	MAX gene associated (MGA)
Clone Name :	hg01059 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 650 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IWI9	100.0	MAX gene-associ...	Homo sapiens
NP_001074010	100.0	MAX gene associ...	Homo sapiens
XP_001150813	99.4	similar to MAX-...	Pan troglodytes
XP_510327	99.4	similar to MAX-...	Pan troglodytes
EAW92512	100.0	hCG1998680, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001092 9 60 PF00010 Basic helix-loop-helix dimerisation region bHLH

HMMSmart IPR001092 14 65 SM00353 Basic helix-loop-helix dimerisation region bHLH

ProfileScan IPR001092 8 60 PS50888 Basic helix-loop-helix dimerisation region bHLH

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	9	60	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	14	65	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	8	60	PS50888	Basic helix-loop-helix dimerisation region bHLH

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCTTATTATCGCCGGACACAC

Primer_r
: TGCCTGATCTGTTAGTCCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTTATTATCGCCGGACACAC
Primer_r	: TGCCTGATCTGTTAGTCCCTG
PCR product length	: 172 (1.2k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0518

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information