| HUGE |
Gene/Protein Characteristic Table for KIAA0525 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00551 |
|---|---|
| Accession No. : | AB011097 |
| Description : | Adipocyte-derived leucine aminopeptidase precursor. |
| HUGO Gene Name : | endoplasmic reticulum aminopeptidase 1 (ERAP1) |
| Clone Name : | hg02148s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0525
|
| Source : | Human adult brain |
| Note : | We replaced hg02148, former representative clones for KIAA0525 with hg02148s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6528 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3660 bp Genome contig ID gi51511721r_96021000 PolyA signal sequence
(ATTAAA,-26)
GGCTACCTTATTAAAACTTTTAGAAATTTCAGTTTFlanking genome sequence
(100000 - 99951)
AAAATTCAATAAGCATTTAGTTTATCAGGTTTCTCTTTTTCTCTTTCTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 96121000 96165406 19 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 951 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GTTCTAGTGAGTGAGTTATGG | |
| : TGAAACCTGACACCGTATACC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : GeneBridge 4 | |
| : GTTCTAGTGAGTGAGTTATGG | |
| : TGAAACCTGACACCGTATACC | |
| : 208 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
