HUGE

Gene/Protein Characteristic Table for KIAA0526

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00552
Accession No. :	AB011098
Description :	Serine palmitoyltransferase 2.
HUGO Gene Name :	serine palmitoyltransferase, long chain base subunit 2 (SPTLC2)
Clone Name :	hg02163 [Vector Info]
Flexi ORF Clone :	pF1KSDA0526
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6814 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4937 bp

Genome contig ID gi51511730r_76943726
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTTGGCGACAGAGGGAGACTCTGTCTC
Flanking genome sequence
(99719 - 99670)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGTGTGCCCAGGCCCCTAGCCATTGCCATGTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 77043445 77152863 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510095	99.5	serine palmitoy...	Pan troglodytes
XP_537524	94.2	similar to seri...	Canis lupus fam...
O15270	100.0	Serine palmitoy...	Homo sapiens
XP_001096042	97.7	similar to seri...	Macaca mulatta
P97363	96.1	Serine palmitoy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004839 215 575 PF00155 Aminotransferase

ScanRegExp IPR001917 423 432 PS00599 Aminotransferase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004839	215	575	PF00155	Aminotransferase
ScanRegExp	IPR001917	423	432	PS00599	Aminotransferase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTACTTGCTTCACGTGGATGC

Primer_r
: TGTGGATAAAGTTGAGGCGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTACTTGCTTCACGTGGATGC
Primer_r	: TGTGGATAAAGTTGAGGCGAG
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4937 bp
Genome contig ID	gi51511730r_76943726
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTTGGCGACAGAGGGAGACTCTGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGGTGTGCCCAGGCCCCTAGCCATTGCCATGTGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	77043445	77152863	12	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0526

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information