HUGE |
Gene/Protein Characteristic Table for KIAA0527 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07030 |
---|---|
Accession No. : | AB011099 |
Description : | Sushi domain-containing protein 5. |
HUGO Gene Name : | sushi domain containing 5 (SUSD5) |
Clone Name : | hg02246 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5005 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2697 bp Genome contig ID gi89161205r_33066541 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CTTCTGAGATATTTAAAATAAATAATTATTGCCCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACAGTTGCTGAATGTATTTTATTTCTAGGCTACTGCACCAAGGTTTAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 33166541 33235711 5 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 768 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CGCAACATGTTTTCTACCCTG | |
: TCTTTGATTATGCTGCCTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: CGCAACATGTTTTCTACCCTG | |
: TCTTTGATTATGCTGCCTCTC | |
: 93 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |