HUGE

Gene/Protein Characteristic Table for KIAA0541

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00094
Accession No. :	AB011113
Description :	WD repeat protein 7.
HUGO Gene Name :	WD repeat domain 7 (WDR7)
Clone Name :	fg05763 [Vector Info]
Flexi ORF Clone :	pF1KA0541
Source :	Human fetal brain
Note :	We replaced hg04294, former representative clones for KIAA0541 with fg05763. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7234 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2587 bp

Genome contig ID gi51511735f_52369651
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTACATATGTGTGTTAAATAAAACAATTGTATTG
Flanking genome sequence
(478370 - 478419)
----+----*----+----*----+----*----+----*----+----*
AAGACTGTTTTTCTCACAATATTACCTTTTCCAGTGTTCACTCATCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 52469651 52848019 28 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4E6	100.0	WD repeat-conta...	Homo sapiens
XP_523934	99.5	rabconnectin-3 ...	Pan troglodytes
XP_001084761	99.3	similar to rabc...	Macaca mulatta
XP_001488140	97.4	WD repeat domai...	Equus caballus
XP_533395	97.0	similar to WD r...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001680 44 58 PR00320 WD40 repeat

IPR001680 495 509 PR00320 WD40 repeat

IPR001680 585 599 PR00320 WD40 repeat

HMMPfam IPR001680 19 57 PF00400 WD40 repeat

IPR001680 64 105 PF00400 WD40 repeat

IPR001680 464 508 PF00400 WD40 repeat

IPR001680 560 598 PF00400 WD40 repeat

IPR001680 1394 1421 PF00400 WD40 repeat

HMMSmart IPR001680 15 57 SM00320 WD40 repeat

IPR001680 63 105 SM00320 WD40 repeat

IPR001680 218 252 SM00320 WD40 repeat

IPR001680 463 508 SM00320 WD40 repeat

IPR001680 511 556 SM00320 WD40 repeat

IPR001680 559 598 SM00320 WD40 repeat

IPR001680 1393 1433 SM00320 WD40 repeat

ProfileScan IPR001680 25 114 PS50294 WD40 repeat

IPR001680 32 59 PS50082 WD40 repeat

IPR001680 470 517 PS50082 WD40 repeat

IPR001680 470 607 PS50294 WD40 repeat

IPR001680 566 607 PS50082 WD40 repeat

IPR001680 1400 1436 PS50082 WD40 repeat

IPR001680 1400 1442 PS50294 WD40 repeat

ScanRegExp IPR001680 44 58 PS00678 WD40 repeat

IPR001680 495 509 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	44	58	PR00320	WD40 repeat
IPR001680	495	509	PR00320	WD40 repeat
IPR001680	585	599	PR00320	WD40 repeat
HMMPfam	IPR001680	19	57	PF00400	WD40 repeat
IPR001680	64	105	PF00400	WD40 repeat
IPR001680	464	508	PF00400	WD40 repeat
IPR001680	560	598	PF00400	WD40 repeat
IPR001680	1394	1421	PF00400	WD40 repeat
HMMSmart	IPR001680	15	57	SM00320	WD40 repeat
IPR001680	63	105	SM00320	WD40 repeat
IPR001680	218	252	SM00320	WD40 repeat
IPR001680	463	508	SM00320	WD40 repeat
IPR001680	511	556	SM00320	WD40 repeat
IPR001680	559	598	SM00320	WD40 repeat
IPR001680	1393	1433	SM00320	WD40 repeat
ProfileScan	IPR001680	25	114	PS50294	WD40 repeat
IPR001680	32	59	PS50082	WD40 repeat
IPR001680	470	517	PS50082	WD40 repeat
IPR001680	470	607	PS50294	WD40 repeat
IPR001680	566	607	PS50082	WD40 repeat
IPR001680	1400	1436	PS50082	WD40 repeat
IPR001680	1400	1442	PS50294	WD40 repeat
ScanRegExp	IPR001680	44	58	PS00678	WD40 repeat
IPR001680	495	509	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCTGTCCTTGTATATGTAGAG

Primer_r
: ACATTCAGCACACATAGAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTGTCCTTGTATATGTAGAG
Primer_r	: ACATTCAGCACACATAGAGTC
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2587 bp
Genome contig ID	gi51511735f_52369651
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTACATATGTGTGTTAAATAAAACAATTGTATTG
Flanking genome sequence (478370 - 478419)	----+--------+--------+--------+--------+----* AAGACTGTTTTTCTCACAATATTACCTTTTCCAGTGTTCACTCATCTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	52469651	52848019	28	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0541

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information