HUGE

Gene/Protein Characteristic Table for KIAA0547

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00558
Accession No. :	AB011119
Description :	Leucine carboxyl methyltransferase 2.
HUGO Gene Name :	leucine carboxyl methyltransferase 2 (LCMT2)
Clone Name :	hh00544 [Vector Info]
Flexi ORF Clone :	pF1KSDA0547
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5658 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09759	100.0	leucine carboxy...	synthetic construct
O60294	99.9	Leucine carboxy...	Homo sapiens
BAF85276	99.7	unnamed protein...	Homo sapiens
XP_001157403	99.0	leucine carboxy...	Pan troglodytes
XP_001106399	95.6	similar to leuc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007213 21 323 PF04072 Leucine carboxyl methyltransferase

IPR011498 490 538 PF07646 Kelch repeat type 2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007213	21	323	PF04072	Leucine carboxyl methyltransferase
IPR011498	490	538	PF07646	Kelch repeat type 2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGATTCTCTGTGGTAGGTTCT

Primer_r
: ACCCTCTGCTATTCTGTTGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGATTCTCTGTGGTAGGTTCT
Primer_r	: ACCCTCTGCTATTCTGTTGCC
PCR product length	: 115 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0547

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information