HUGE

Gene/Protein Characteristic Table for KIAA0562

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00097
Accession No. :	AB011134
Description :
HUGO Gene Name :
Clone Name :	hh01779 [Vector Info]
Flexi ORF Clone :	pF1KA0562
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5848 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2757 bp

Genome contig ID gi89161185r_3618513
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
CACCCAGAGTATATTAATATAATAAAAAGATCACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGTTTTGTCACTTTATTTCAACATTACAATTAAAAAGTAATTTGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 3718513 3763611 23 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW71481	99.9	glycine-, gluta...	Homo sapiens
XP_001084851	97.1	glycine-, gluta...	Macaca mulatta
BAE29108	80.2	unnamed protein...	Mus musculus
XP_001076921	79.5	similar to glyc...	Rattus norvegicus
XP_001365476	74.7	similar to glyc...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 529 565 PF02985 HEAT

IPR000357 610 646 PF02985 HEAT

ScanRegExp IPR001005 454 462 PS00037 SANT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	529	565	PF02985	HEAT
IPR000357	610	646	PF02985	HEAT
ScanRegExp	IPR001005	454	462	PS00037	SANT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGCTGGAACTGAGGTAGACAC

Primer_r
: AGACTGTTTTTTGAGGGTTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCTGGAACTGAGGTAGACAC
Primer_r	: AGACTGTTTTTTGAGGGTTGG
PCR product length	: 299 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2757 bp
Genome contig ID	gi89161185r_3618513
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- CACCCAGAGTATATTAATATAATAAAAAGATCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTTTTGTCACTTTATTTCAACATTACAATTAAAAAGTAATTTGTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	3718513	3763611	23	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0562

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information