HUGE |
Gene/Protein Characteristic Table for KIAA0564 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07653 |
---|---|
Accession No. : | AB011136 |
Description : | OTTHUMP00000018323. |
HUGO Gene Name : | |
Clone Name : | hh01811 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5688 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 1441 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TAGGGAGAGGGGTGATAGAAC | |
: AAACGTTAGGGCACCAGTGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: GeneBridge 4 | |
: TAGGGAGAGGGGTGATAGAAC | |
: AAACGTTAGGGCACCAGTGAG | |
: 177 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |