HUGE

Gene/Protein Characteristic Table for KIAA0564

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07653
Accession No. :	AB011136
Description :	OTTHUMP00000018323.
HUGO Gene Name :
Clone Name :	hh01811 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5688 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1441 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI39586	100.0	novel protein [...	Homo sapiens
XP_001091849	98.2	similar to F11C...	Macaca mulatta
XP_848634	92.8	similar to F11C...	Canis lupus fam...
XP_214237	86.5	similar to F11C...	Rattus norvegicus
XP_920456	85.8	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011704 1 147 PF07728 ATPase associated with various cellular activities

IPR011704 312 467 PF07728 ATPase associated with various cellular activities

HMMSmart IPR002035 1248 1437 SM00327 von Willebrand factor

ProfileScan IPR002035 1250 1432 PS50234 von Willebrand factor

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011704	1	147	PF07728	ATPase associated with various cellular activities
IPR011704	312	467	PF07728	ATPase associated with various cellular activities
HMMSmart	IPR002035	1248	1437	SM00327	von Willebrand factor
ProfileScan	IPR002035	1250	1432	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TAGGGAGAGGGGTGATAGAAC

Primer_r
: AAACGTTAGGGCACCAGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGGGAGAGGGGTGATAGAAC
Primer_r	: AAACGTTAGGGCACCAGTGAG
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0564

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information