HUGE

Gene/Protein Characteristic Table for KIAA0582

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00567
Accession No. :	AB011154
Description :	Centrosomal protein of 68 kDa.
HUGO Gene Name :
Clone Name :	fh15957 [Vector Info]
Flexi ORF Clone :	pF1KSDA0582
Source :	Human fetal brain
Note :	We replaced hj00648, former representative clones for KIAA0582 with fh15957. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5857 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3369 bp

Genome contig ID gi89161199f_65036999
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GCCTGTTTAGTGAAAAATAAAAATTAAAAAAACCT
Flanking genome sequence
(130644 - 130693)
----+----*----+----*----+----*----+----*----+----*
ATTCATTTTTGGCTTGTGTTTAGCTTAAATTTTATCATTAAATTAAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 65136999 65167641 7 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q76N32	100.0	Centrosomal pro...	Homo sapiens
Q5RCQ2	95.0	Centrosomal pro...	Pongo abelii
BAG65012	99.7	unnamed protein...	Homo sapiens
BAG62760	97.9	unnamed protein...	Homo sapiens
AAH30534	98.6	CEP68 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACGGCATGGCATCACAGTATC

Primer_r
: GCAACTGACAAATTCCTGAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACGGCATGGCATCACAGTATC
Primer_r	: GCAACTGACAAATTCCTGAAG
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3369 bp
Genome contig ID	gi89161199f_65036999
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GCCTGTTTAGTGAAAAATAAAAATTAAAAAAACCT
Flanking genome sequence (130644 - 130693)	----+--------+--------+--------+--------+----* ATTCATTTTTGGCTTGTGTTTAGCTTAAATTTTATCATTAAATTAAGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	65136999	65167641	7	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0582

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information