HUGE |
Gene/Protein Characteristic Table for KIAA0583 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01097 |
---|---|
Accession No. : | AB011155 |
Description : | Discs large homolog 5. |
HUGO Gene Name : | discs, large homolog 5 (Drosophila) (DLG5) |
Clone Name : | af01829 [Vector Info] |
Flexi ORF Clone : | pF1KA0583
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced hj00729, former representative clones for KIAA0583 with af01829. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7507 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1647 bp Genome contig ID gi89161187r_79120557 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AGGCTTTAGTACAACAAATAAAGGTCAATTTCTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGGCTGTGTTTGAAGATGTGAGTTTTTAATCTCTTCCTAGTCAGTCAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 79220557 79356384 32 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1952 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACAAGTTTCAGTCCTCAATGC | |
: GAAAATCCCAGTCTGTCAGCT | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: ACAAGTTTCAGTCCTCAATGC | |
: GAAAATCCCAGTCTGTCAGCT | |
: 206 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |