HUGE

Gene/Protein Characteristic Table for KIAA0583

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01097
Accession No. :	AB011155
Description :	Discs large homolog 5.
HUGO Gene Name :	discs, large homolog 5 (Drosophila) (DLG5)
Clone Name :	af01829 [Vector Info]
Flexi ORF Clone :	pF1KA0583
Source :	Human brain (amygdala)
Note :	We replaced hj00729, former representative clones for KIAA0583 with af01829. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7507 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1647 bp

Genome contig ID gi89161187r_79120557
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGGCTTTAGTACAACAAATAAAGGTCAATTTCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGCTGTGTTTGAAGATGTGAGTTTTTAATCTCTTCCTAGTCAGTCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 79220557 79356384 32 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46795	100.0	Discs, large ho...	Homo sapiens
Q8TDM6	99.9	Disks large hom...	Homo sapiens
EAW54611	100.0	discs, large ho...	Homo sapiens
AAL83938	99.9	DLG5 [Homo sapi...	Homo sapiens
AAL83937	99.9	DLG5 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001315 39 122 PF00619 Caspase Recruitment

IPR006907 160 249 PF04822 Protein of unknown function DUF622

IPR001478 655 740 PF00595 PDZ/DHR/GLGF

IPR001478 755 826 PF00595 PDZ/DHR/GLGF

IPR001478 1383 1459 PF00595 PDZ/DHR/GLGF

IPR001478 1534 1612 PF00595 PDZ/DHR/GLGF

IPR011511 1630 1692 PF07653 Variant SH3

IPR008144 1834 1873 PF00625 Guanylate kinase

HMMSmart IPR001478 666 743 SM00228 PDZ/DHR/GLGF

IPR001478 751 829 SM00228 PDZ/DHR/GLGF

IPR001478 1391 1462 SM00228 PDZ/DHR/GLGF

IPR001478 1543 1615 SM00228 PDZ/DHR/GLGF

IPR001452 1629 1693 SM00326 Src homology-3

IPR008145 1755 1941 SM00072 Guanylate kinase/L-type calcium channel region

ProfileScan IPR001315 34 123 PS50209 Caspase Recruitment

IPR001478 653 743 PS50106 PDZ/DHR/GLGF

IPR001478 738 829 PS50106 PDZ/DHR/GLGF

IPR001478 1383 1462 PS50106 PDZ/DHR/GLGF

IPR001478 1534 1615 PS50106 PDZ/DHR/GLGF

IPR001452 1626 1694 PS50002 Src homology-3

IPR008144 1808 1938 PS50052 Guanylate kinase

ScanRegExp IPR000408 1549 1559 PS00626 Regulator of chromosome condensation

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001315	39	122	PF00619	Caspase Recruitment
IPR006907	160	249	PF04822	Protein of unknown function DUF622
IPR001478	655	740	PF00595	PDZ/DHR/GLGF
IPR001478	755	826	PF00595	PDZ/DHR/GLGF
IPR001478	1383	1459	PF00595	PDZ/DHR/GLGF
IPR001478	1534	1612	PF00595	PDZ/DHR/GLGF
IPR011511	1630	1692	PF07653	Variant SH3
IPR008144	1834	1873	PF00625	Guanylate kinase
HMMSmart	IPR001478	666	743	SM00228	PDZ/DHR/GLGF
IPR001478	751	829	SM00228	PDZ/DHR/GLGF
IPR001478	1391	1462	SM00228	PDZ/DHR/GLGF
IPR001478	1543	1615	SM00228	PDZ/DHR/GLGF
IPR001452	1629	1693	SM00326	Src homology-3
IPR008145	1755	1941	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001315	34	123	PS50209	Caspase Recruitment
IPR001478	653	743	PS50106	PDZ/DHR/GLGF
IPR001478	738	829	PS50106	PDZ/DHR/GLGF
IPR001478	1383	1462	PS50106	PDZ/DHR/GLGF
IPR001478	1534	1615	PS50106	PDZ/DHR/GLGF
IPR001452	1626	1694	PS50002	Src homology-3
IPR008144	1808	1938	PS50052	Guanylate kinase
ScanRegExp	IPR000408	1549	1559	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACAAGTTTCAGTCCTCAATGC

Primer_r
: GAAAATCCCAGTCTGTCAGCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAAGTTTCAGTCCTCAATGC
Primer_r	: GAAAATCCCAGTCTGTCAGCT
PCR product length	: 206 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1647 bp
Genome contig ID	gi89161187r_79120557
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGCTTTAGTACAACAAATAAAGGTCAATTTCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGCTGTGTTTGAAGATGTGAGTTTTTAATCTCTTCCTAGTCAGTCAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	79220557	79356384	32	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0583

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information