HUGE

Gene/Protein Characteristic Table for KIAA0585

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00568
Accession No. :	AB011157
Description :	JmjC domain-containing protein 6.
HUGO Gene Name :	jumonji domain containing 6 (JMJD6)
Clone Name :	hj00998 [Vector Info]
Flexi ORF Clone :	pF1KSDA0585
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5100 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3849 bp

Genome contig ID gi51511734r_72120514
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGTTCATCATTTTAAATAAAGCAACATGATTTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTGTGTTTTTGGCATTGTTTTGTCCTTATTTTCTTTCTTACTCATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 72220514 72234158 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW89434	1.2e-167	100.0	phosphatidylser...	Homo sapiens
AAH47003	3.6e-163	100.0	Jumonji domain ...	Homo sapiens
Q5R6G2	2.4e-162	100.0	Histone arginin...	Pongo abelii
BAG51050	5e-162	99.8	unnamed protein...	Homo sapiens
XP_849080	2e-160	98.3	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013129 176 290 PF02373 Transcription factor jumonji

HMMSmart IPR003347 143 307 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

ProfileScan IPR003347 143 307 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	176	290	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	143	307	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	143	307	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCTAAGCCCCAGTGAACCTCC

Primer_r
: TACCAACCCAATAGCAGATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: TCTAAGCCCCAGTGAACCTCC
Primer_r	: TACCAACCCAATAGCAGATCC
PCR product length	: 205 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3849 bp
Genome contig ID	gi51511734r_72120514
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTTCATCATTTTAAATAAAGCAACATGATTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTGTGTTTTTGGCATTGTTTTGTCCTTATTTTCTTTCTTACTCATTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	72220514	72234158	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0585

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information