HUGE

Gene/Protein Characteristic Table for KIAA0595

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00105
Accession No. :	AB011167
Description :	peroxisome proliferator-activated receptor gamma, coactivator-related 1.
HUGO Gene Name :	peroxisome proliferator-activated receptor gamma, coactivator-related 1 (PPRC1)
Clone Name :	hj02929s1 [Vector Info]
Flexi ORF Clone :	pF1KA0595
Source :	Human adult brain
Note :	We replaced hj02929, former representative clones for KIAA0595 with hj02929s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5297 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 295 bp

Genome contig ID gi89161187f_103782809
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTCACTATGCAGACTAATAAACATCAACTAGAGAG
Flanking genome sequence
(117264 - 117313)
----+----*----+----*----+----*----+----*----+----*
AACTCCCAACTGCTGTTGTGCGTCTTTATATGGTGCTAATGCCAAATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 103882809 103900071 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VV67	100.0	Peroxisome prol...	Homo sapiens
AAH63829	99.9	Peroxisome prol...	Homo sapiens
AAK11573	99.8	PGC-1 related c...	Homo sapiens
EAW49719	99.7	peroxisome prol...	Homo sapiens
EAW49720	99.6	peroxisome prol...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 1547 1608 PF00076 RNA recognition motif

HMMSmart IPR000504 1546 1617 SM00360 RNA recognition motif

ProfileScan IPR000504 1545 1621 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	1547	1608	PF00076	RNA recognition motif
HMMSmart	IPR000504	1546	1617	SM00360	RNA recognition motif
ProfileScan	IPR000504	1545	1621	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCTTCGTCACTTATCGCTATG

Primer_r
: ATCAAAGGGCTGCTCATCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: CCR
Primer_f	: GCTTCGTCACTTATCGCTATG
Primer_r	: ATCAAAGGGCTGCTCATCTGC
PCR product length	: 89 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	295 bp
Genome contig ID	gi89161187f_103782809
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCACTATGCAGACTAATAAACATCAACTAGAGAG
Flanking genome sequence (117264 - 117313)	----+--------+--------+--------+--------+----* AACTCCCAACTGCTGTTGTGCGTCTTTATATGGTGCTAATGCCAAATGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	103882809	103900071	14	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0595

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information