HUGE |
Gene/Protein Characteristic Table for KIAA0607 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00573 |
---|---|
Accession No. : | AB011179 |
Description : | neurochondrin isoform 2. |
HUGO Gene Name : | |
Clone Name : | hh00181a [Vector Info] |
Flexi ORF Clone : | pF1KSDA0607
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3311 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1114 bp Genome contig ID gi89161185f_35696032 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGCACATGTGGACACTCAATAAATGTTCATTGGTGFlanking genome sequence
(108930 - 108979) ----+----*----+----*----+----*----+----*----+----*
ACGAGAAGCCTCCTGCGTGGTCTGCCCTGCACCTGCTCTCTCCCTTCCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 35796032 35804960 7 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 731 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR008709 | 20 | 731 | PF05536 | Neurochondrin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CCTGTCCTTATCCCTGCTTGG | |
: GTAATCACTGGGGAAACATGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CCTGTCCTTATCCCTGCTTGG | |
: GTAATCACTGGGGAAACATGC | |
: 126 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |