HUGE |
Gene/Protein Characteristic Table for KIAA0609 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00107 |
---|---|
Accession No. : | AB011181 |
Description : | Glycosyltransferase-like protein LARGE1. |
HUGO Gene Name : | like-glycosyltransferase (LARGE) |
Clone Name : | hk00807 [Vector Info] |
Flexi ORF Clone : | pF1KA0609 |
Source : | Human adult brain |
Note : | We replaced hh00979b, former representative clones for KIAA0609 with hk00807. (2000/1/08) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3884 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1338 bp Genome contig ID gi89161203r_31899075 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AGCGAAAGCTGCATTTAATAAATGAAAGTACAGACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGTTTCTTCCCCATTCCCCTCCCACTCTTGCAGGAAGCTACTGAGACACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 31999075 32646331 14 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 769 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CAACCACCTTCACCTTCACAC | |
: AATACAAACAGCCCAGCAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: CAACCACCTTCACCTTCACAC | |
: AATACAAACAGCCCAGCAGAG | |
: 108 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |