HUGE

Gene/Protein Characteristic Table for KIAA0615

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00576
Accession No. :	AB014515
Description :	NEDD4-binding protein 1 (Fragment).
HUGO Gene Name :
Clone Name :	hg01354a [Vector Info]
Flexi ORF Clone :	pF1KSDA0615
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3319 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 943 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_520627	99.4	Nedd4 binding p...	Pan troglodytes
XP_001109863	97.9	Nedd4 binding p...	Macaca mulatta
O75113	100.0	NEDD4-binding p...	Homo sapiens
AAI60019	99.9	NEDD4 binding p...	synthetic construct
AAI08289	99.9	N4BP1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002321	1.6e-29	30.4	KIAA0323
AB037726	2.8e-24	49.5	KIAA1305
AB051513	3.1e-17	50.7	KIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCACCCATACATGAAAGATC

Primer_r
: CATTCCCATCAGGTACAGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCACCCATACATGAAAGATC
Primer_r	: CATTCCCATCAGGTACAGGTG
PCR product length	: 130 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0615

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information