HUGE |
Gene/Protein Characteristic Table for KIAA0637 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01598 |
---|---|
Accession No. : | AB014537 |
Description : | Zinc finger BED domain-containing protein 4. |
HUGO Gene Name : | zinc finger, BED-type containing 4 (ZBED4) |
Clone Name : | hj03305 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0637
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5217 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 1175 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTATGATAGGGAAGATGCGGC | |
: AAGGTCGTAGGCAAATGAGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: TTATGATAGGGAAGATGCGGC | |
: AAGGTCGTAGGCAAATGAGTG | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |