HUGE

Gene/Protein Characteristic Table for KIAA0645

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00588
Accession No. :	AB014545
Description :	DEP domain-containing protein 5.
HUGO Gene Name :	DEP domain containing 5 (DEPDC5)
Clone Name :	hj03630 [Vector Info]
Flexi ORF Clone :	pF1KSDA0645
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5292 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75140	100.0	DEP domain-cont...	Homo sapiens
ACE77702	96.0	DEP domain cont...	Sorex araneus
XP_001928021	95.7	similar to DEPD...	Sus scrofa
EDL37406	94.7	DEP domain cont...	Mus musculus
EDM00137	94.2	DEP domain cont...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000591 1162 1235 PF00610 Pleckstrin/ G-protein

HMMSmart IPR000591 1162 1237 SM00049 Pleckstrin/ G-protein

ProfileScan IPR000591 1162 1237 PS50186 Pleckstrin/ G-protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000591	1162	1235	PF00610	Pleckstrin/ G-protein
HMMSmart	IPR000591	1162	1237	SM00049	Pleckstrin/ G-protein
ProfileScan	IPR000591	1162	1237	PS50186	Pleckstrin/ G-protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCCCACGACAAGTCTTCTAC

Primer_r
: GGTGAAGGAAAAGGATGCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCCCACGACAAGTCTTCTAC
Primer_r	: GGTGAAGGAAAAGGATGCTAC
PCR product length	: 203 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0645

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information