HUGE

Gene/Protein Characteristic Table for KIAA0657

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06218
Accession No. :	AB014557
Description :	Obscurin-like protein 1 precursor.
HUGO Gene Name :	obscurin-like 1 (OBSL1)
Clone Name :	hk01859s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk01859, former representative clones for KIAA0657 with hk01859s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5382 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1667 bp

Genome contig ID gi89161199r_220023695
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAGAGAGACAAGGAACAATAAAAGTGCTACAGCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCCTTGCCTCTCTGAGTGATGTGGGGGGGCAGACCTTGCCTGGAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 220123695 220143707 16 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75147	100.0	Obscurin-like p...	Homo sapiens
EAW70766	99.9	chondroitin pol...	Homo sapiens
ABO42328	92.4	obscurin-like 1...	Homo sapiens
ABO42327	92.3	obscurin-like 1...	Homo sapiens
ACJ76613	86.6	obscurin-like 1...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046776	1.3e-14	27.1	KIAA1556
D86983	2.3e-07	25.1	KIAA0230
AB046788	9.6e-07	25.1	KIAA1568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013098 30 62 PF07679 Immunoglobulin I-set

IPR013098 87 172 PF07679 Immunoglobulin I-set

IPR013098 177 262 PF07679 Immunoglobulin I-set

IPR003961 351 437 PF00041 Fibronectin

IPR013151 567 626 PF00047 Immunoglobulin

IPR013151 658 717 PF00047 Immunoglobulin

IPR013151 749 808 PF00047 Immunoglobulin

IPR013151 840 899 PF00047 Immunoglobulin

IPR013151 932 991 PF00047 Immunoglobulin

IPR013098 1044 1087 PF07679 Immunoglobulin I-set

IPR013151 1118 1151 PF00047 Immunoglobulin

HMMSmart IPR003599 2 63 SM00409 Immunoglobulin subtype

IPR003599 88 173 SM00409 Immunoglobulin subtype

IPR003598 94 162 SM00408 Immunoglobulin subtype 2

IPR003599 183 263 SM00409 Immunoglobulin subtype

IPR003598 189 255 SM00408 Immunoglobulin subtype 2

IPR003599 271 347 SM00409 Immunoglobulin subtype

IPR003599 458 547 SM00409 Immunoglobulin subtype

IPR003599 559 640 SM00409 Immunoglobulin subtype

IPR003598 565 631 SM00408 Immunoglobulin subtype 2

IPR003599 650 729 SM00409 Immunoglobulin subtype

IPR003598 656 722 SM00408 Immunoglobulin subtype 2

IPR003599 741 820 SM00409 Immunoglobulin subtype

IPR003598 747 813 SM00408 Immunoglobulin subtype 2

IPR003599 832 911 SM00409 Immunoglobulin subtype

IPR003598 838 904 SM00408 Immunoglobulin subtype 2

IPR003599 924 1007 SM00409 Immunoglobulin subtype

IPR003598 930 996 SM00408 Immunoglobulin subtype 2

IPR003599 1020 1099 SM00409 Immunoglobulin subtype

IPR003598 1026 1092 SM00408 Immunoglobulin subtype 2

ProfileScan IPR007110 79 166 PS50835 Immunoglobulin-like

IPR007110 175 261 PS50835 Immunoglobulin-like

IPR003961 353 446 PS50853 Fibronectin

IPR007110 550 636 PS50835 Immunoglobulin-like

IPR007110 640 729 PS50835 Immunoglobulin-like

IPR007110 738 818 PS50835 Immunoglobulin-like

IPR007110 822 911 PS50835 Immunoglobulin-like

IPR007110 913 1005 PS50835 Immunoglobulin-like

IPR007110 1009 1087 PS50835 Immunoglobulin-like

IPR007110 1101 1140 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	30	62	PF07679	Immunoglobulin I-set
IPR013098	87	172	PF07679	Immunoglobulin I-set
IPR013098	177	262	PF07679	Immunoglobulin I-set
IPR003961	351	437	PF00041	Fibronectin
IPR013151	567	626	PF00047	Immunoglobulin
IPR013151	658	717	PF00047	Immunoglobulin
IPR013151	749	808	PF00047	Immunoglobulin
IPR013151	840	899	PF00047	Immunoglobulin
IPR013151	932	991	PF00047	Immunoglobulin
IPR013098	1044	1087	PF07679	Immunoglobulin I-set
IPR013151	1118	1151	PF00047	Immunoglobulin
HMMSmart	IPR003599	2	63	SM00409	Immunoglobulin subtype
IPR003599	88	173	SM00409	Immunoglobulin subtype
IPR003598	94	162	SM00408	Immunoglobulin subtype 2
IPR003599	183	263	SM00409	Immunoglobulin subtype
IPR003598	189	255	SM00408	Immunoglobulin subtype 2
IPR003599	271	347	SM00409	Immunoglobulin subtype
IPR003599	458	547	SM00409	Immunoglobulin subtype
IPR003599	559	640	SM00409	Immunoglobulin subtype
IPR003598	565	631	SM00408	Immunoglobulin subtype 2
IPR003599	650	729	SM00409	Immunoglobulin subtype
IPR003598	656	722	SM00408	Immunoglobulin subtype 2
IPR003599	741	820	SM00409	Immunoglobulin subtype
IPR003598	747	813	SM00408	Immunoglobulin subtype 2
IPR003599	832	911	SM00409	Immunoglobulin subtype
IPR003598	838	904	SM00408	Immunoglobulin subtype 2
IPR003599	924	1007	SM00409	Immunoglobulin subtype
IPR003598	930	996	SM00408	Immunoglobulin subtype 2
IPR003599	1020	1099	SM00409	Immunoglobulin subtype
IPR003598	1026	1092	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	79	166	PS50835	Immunoglobulin-like
IPR007110	175	261	PS50835	Immunoglobulin-like
IPR003961	353	446	PS50853	Fibronectin
IPR007110	550	636	PS50835	Immunoglobulin-like
IPR007110	640	729	PS50835	Immunoglobulin-like
IPR007110	738	818	PS50835	Immunoglobulin-like
IPR007110	822	911	PS50835	Immunoglobulin-like
IPR007110	913	1005	PS50835	Immunoglobulin-like
IPR007110	1009	1087	PS50835	Immunoglobulin-like
IPR007110	1101	1140	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCTCTTTGTGTACTGGTGTCC

Primer_r
: GCAAACGCCTTCCAAGCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTCTTTGTGTACTGGTGTCC
Primer_r	: GCAAACGCCTTCCAAGCTGTC
PCR product length	: 154 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1667 bp
Genome contig ID	gi89161199r_220023695
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGAGAGACAAGGAACAATAAAAGTGCTACAGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCCTTGCCTCTCTGAGTGATGTGGGGGGGCAGACCTTGCCTGGAGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	220123695	220143707	16	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0657

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information