HUGE |
Gene/Protein Characteristic Table for KIAA0657 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06218 |
---|---|
Accession No. : | AB014557 |
Description : | Obscurin-like protein 1 precursor. |
HUGO Gene Name : | obscurin-like 1 (OBSL1) |
Clone Name : | hk01859s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hk01859, former representative clones for KIAA0657 with hk01859s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5382 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1667 bp Genome contig ID gi89161199r_220023695 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TAGAGAGACAAGGAACAATAAAAGTGCTACAGCTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTCCTTGCCTCTCTGAGTGATGTGGGGGGGCAGACCTTGCCTGGAGCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 220123695 220143707 16 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1237 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCTCTTTGTGTACTGGTGTCC | |
: GCAAACGCCTTCCAAGCTGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: GCTCTTTGTGTACTGGTGTCC | |
: GCAAACGCCTTCCAAGCTGTC | |
: 154 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |