HUGE |
Gene/Protein Characteristic Table for KIAA0678 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04808 |
---|---|
Accession No. : | AB014578 |
Description : | DnaJ homolog subfamily C member 13. |
HUGO Gene Name : | DnaJ (Hsp40) homolog, subfamily C, member 13 (DNAJC13) |
Clone Name : | ef02254 [Vector Info] |
Source : | |
Note : | We replaced hk02710, former representative clones for KIAA0678 with ef02254. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7595 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 749 bp Genome contig ID gi89161205f_133519194 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
TAAAAATAAAGGGAATTGACTGCTTTGTTAATGAGFlanking genome sequence
(221373 - 221422) ----+----*----+----*----+----*----+----*----+----*
ATATATTTGTTCTAGTTTAATCTTTCCGTTTGAAGACCTCATATATCTAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 133619194 133740565 56 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2257 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AGCATGACTGTAGGGTTGAGC | |
: AGGTTAATGATTGAGGATGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: AGCATGACTGTAGGGTTGAGC | |
: AGGTTAATGATTGAGGATGCC | |
: 173 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |