HUGE

Gene/Protein Characteristic Table for KIAA0679

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01602
Accession No. :	AB014579
Description :	Bifunctional protein NCOAT.
HUGO Gene Name :
Clone Name :	hk02739s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0679
Source :	Human adult brain
Note :	We replaced hk02739, former representative clones for KIAA0679 with hk02739s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1999 bp

Genome contig ID gi89161187r_103434199
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
AAGACCATGCAAGAGGCAAAATAAAACTTGAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGCTTGTCGTGTTGTATTGTGTGAATCTATTTCCTGTCTGCCCCCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 103534199 103567774 16 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60502	100.0	Bifunctional pr...	Homo sapiens
XP_534996	99.2	similar to meni...	Canis lupus fam...
XP_001499585	99.2	meningioma expr...	Equus caballus
XP_001927682	98.9	meningioma expr...	Sus scrofa
Q8VIJ5	97.4	Bifunctional pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011496 63 380 PF07555 Hyaluronidase eukaryotic/prokaryotic

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011496	63	380	PF07555	Hyaluronidase eukaryotic/prokaryotic

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATGAAGCTGGCAGATAGTCG

Primer_r
: ACAATGCTTTAGGGCTCTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATGAAGCTGGCAGATAGTCG
Primer_r	: ACAATGCTTTAGGGCTCTCTC
PCR product length	: 221 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1999 bp
Genome contig ID	gi89161187r_103434199
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AAGACCATGCAAGAGGCAAAATAAAACTTGAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGCTTGTCGTGTTGTATTGTGTGAATCTATTTCCTGTCTGCCCCCTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	103534199	103567774	16	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0679

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information