HUGE |
Gene/Protein Characteristic Table for KIAA0679 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01602 |
---|---|
Accession No. : | AB014579 |
Description : | Bifunctional protein NCOAT. |
HUGO Gene Name : | |
Clone Name : | hk02739s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0679
![]() |
Source : | Human adult brain |
Note : | We replaced hk02739, former representative clones for KIAA0679 with hk02739s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4755 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1999 bp Genome contig ID gi89161187r_103434199 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
AAGACCATGCAAGAGGCAAAATAAAACTTGAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGCTTGTCGTGTTGTATTGTGTGAATCTATTTCCTGTCTGCCCCCTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 103534199 103567774 16 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 917 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011496 | 63 | 380 | PF07555 | Hyaluronidase eukaryotic/prokaryotic |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CATGAAGCTGGCAGATAGTCG | |
: ACAATGCTTTAGGGCTCTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: CATGAAGCTGGCAGATAGTCG | |
: ACAATGCTTTAGGGCTCTCTC | |
: 221 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |