HUGE

Gene/Protein Characteristic Table for KIAA0683

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00115
Accession No. :	AB014583
Description :	TEL2, telomere maintenance 2, homolog.
HUGO Gene Name :	TEL2, telomere maintenance 2, homolog (S. cerevisiae) (TELO2)
Clone Name :	fk02589 [Vector Info]
Flexi ORF Clone :	pF1KA0683
Source :	Human fetal brain
Note :	We replaced hk02952, former representative clones for KIAA0683 with fk02589. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 3309 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 516 bp

Genome contig ID gi51511732f_1383365
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGCACGGGCTCTCAGAAAATAAACTGCTTTATTGG
Flanking genome sequence
(117091 - 117140)
----+----*----+----*----+----*----+----*----+----*
AATTACAGGAGTGTTGGTGGCCGGTGGGCAGAGCCTAGCAGGGGGTGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 1483365 1500454 21 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 844 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10366	100.0	telomere mainte...	synthetic construct
XP_001089282	94.0	similar to CG31...	Macaca mulatta
EDL22399	74.9	RIKEN cDNA 1200...	Mus musculus
EDL22400	74.8	RIKEN cDNA 1200...	Mus musculus
XP_220236	75.1	similar to CG31...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGCCCAGTGTATTTTTAGCAG

Primer_r
: TTGTAGCGAGGCCAGGTCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCCCAGTGTATTTTTAGCAG
Primer_r	: TTGTAGCGAGGCCAGGTCTTC
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	516 bp
Genome contig ID	gi51511732f_1383365
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGCACGGGCTCTCAGAAAATAAACTGCTTTATTGG
Flanking genome sequence (117091 - 117140)	----+--------+--------+--------+--------+----* AATTACAGGAGTGTTGGTGGCCGGTGGGCAGAGCCTAGCAGGGGGTGCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	1483365	1500454	21	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0683

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information