HUGE |
Gene/Protein Characteristic Table for KIAA0683 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00115 |
---|---|
Accession No. : | AB014583 |
Description : | TEL2, telomere maintenance 2, homolog. |
HUGO Gene Name : | TEL2, telomere maintenance 2, homolog (S. cerevisiae) (TELO2) |
Clone Name : | fk02589 [Vector Info] |
Flexi ORF Clone : | pF1KA0683
![]() |
Source : | Human fetal brain |
Note : | We replaced hk02952, former representative clones for KIAA0683 with fk02589. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3309 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 516 bp Genome contig ID gi51511732f_1383365 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GGCACGGGCTCTCAGAAAATAAACTGCTTTATTGGFlanking genome sequence
(117091 - 117140) ----+----*----+----*----+----*----+----*----+----*
AATTACAGGAGTGTTGGTGGCCGGTGGGCAGAGCCTAGCAGGGGGTGCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 1483365 1500454 21 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 844 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GGCCCAGTGTATTTTTAGCAG | |
: TTGTAGCGAGGCCAGGTCTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: GGCCCAGTGTATTTTTAGCAG | |
: TTGTAGCGAGGCCAGGTCTTC | |
: 111 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |