HUGE

Gene/Protein Characteristic Table for KIAA0691

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01111
Accession No. :	AB014591
Description :	CCR4-NOT transcription complex subunit 3.
HUGO Gene Name :	CCR4-NOT transcription complex, subunit 3 (CNOT3)
Clone Name :	hk03735 [Vector Info]
Flexi ORF Clone :	pF1KA0691
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 273 bp

Genome contig ID gi42406306f_59236924
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTTGGAAAATATTTATGAATAAATAGTTTTATATG
Flanking genome sequence
(114308 - 114357)
----+----*----+----*----+----*----+----*----+----*
ACGGCTGGCAGCAGCGGCCTCTCCTGTACCCCCTCAGGAGTCAGTGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 59336924 59351230 17 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 762 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75175	1.9e-169	100.0	CCR4-NOT transc...	Homo sapiens
ABX52171	4.5e-167	98.9	CCR4-NOT transc...	Papio anubis
ACH53093	2.5e-165	97.6	CCR4-NOT transc...	Otolemur garnettii
XP_541428	1e-163	96.7	similar to CCR4...	Canis lupus fam...
ACK44299	6.4e-163	96.5	CCR4-NOT transc...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007207 11 251 PF04065 Not CCR4-Not complex component

IPR007282 589 757 PF04153 NOT2/NOT3/NOT5

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007207	11	251	PF04065	Not CCR4-Not complex component
IPR007282	589	757	PF04153	NOT2/NOT3/NOT5

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGGCCCTAAAGAAGCAGTC

Primer_r
: GTCAAAGTAGATGTAGGTGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGTAACAGCAGTGCCGGTGG
Primer_r	: CTGAGTTGTTCCCTGAGCCTG
PCR product length	: 242 bp
PCR conditions	: 95 °C15 sec70 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	273 bp
Genome contig ID	gi42406306f_59236924
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTGGAAAATATTTATGAATAAATAGTTTTATATG
Flanking genome sequence (114308 - 114357)	----+--------+--------+--------+--------+----* ACGGCTGGCAGCAGCGGCCTCTCCTGTACCCCCTCAGGAGTCAGTGAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	59336924	59351230	17	99.5	Perfect prediction

Primer_f	: CAAGGCCCTAAAGAAGCAGTC
Primer_r	: GTCAAAGTAGATGTAGGTGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0691

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information