HUGE

Gene/Protein Characteristic Table for KIAA0692

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05616
Accession No. :	AB014592
Description :
HUGO Gene Name :
Clone Name :	hk03772 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4088 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 783 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86XL3	100.0	Ankyrin repeat ...	Homo sapiens
NP_055929	99.9	ankyrin repeat ...	Homo sapiens
AAH43157	99.6	ANKLE2 protein ...	Homo sapiens
CAH90419	96.8	hypothetical pr...	Pongo abelii
CAI29623	96.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCATTTAGAGGTTTGAGTCC

Primer_r
: GTAACACCCAGGAAGAAACCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCATTTAGAGGTTTGAGTCC
Primer_r	: GTAACACCCAGGAAGAAACCG
PCR product length	: 154 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0692

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information