HUGE |
Gene/Protein Characteristic Table for KIAA0700 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01991 |
---|---|
Accession No. : | AB014600 |
Description : | Paired amphipathic helix protein Sin3b. |
HUGO Gene Name : | SIN3 homolog B, transcription regulator (yeast) (SIN3B) |
Clone Name : | fh14187 [Vector Info] |
Flexi ORF Clone : | pF1KA0700
![]() |
Source : | Human fetal brain |
Note : | We replaced hg01440, former representative clones for KIAA0700 with fh14187. (1999/2/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5037 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1623 bp Genome contig ID gi42406306f_16701211 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
TATTTGCACATTAAAGTTAATAATTGAATATTGACFlanking genome sequence
(150952 - 151001) ----+----*----+----*----+----*----+----*----+----*
ATCAAGCCGTGAGGGTGTGTTGGTCTTCCTGTGAGAGCCTTGCTGACTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 16801211 16852161 19 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1137 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCCAAGAATCCCAAGTGACTG | |
: TGGCAAGGGTGGCGGTTATTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: CATTCAAAACAGCTGCAAAGG | |
: GGCACTTTGTACACACCCTGG | |
: 234 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |