HUGE

Gene/Protein Characteristic Table for KIAA0705

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05908
Accession No. :	AB014605
Description :	Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2.
HUGO Gene Name :	membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2)
Clone Name :	hg03359s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg03359, former representative clones for KIAA0705 with hg03359s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 6795 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2234 bp

Genome contig ID gi89161213r_77384334
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
ATATTCTAAAACACTGTCAAATAAAATATATATCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATCTTTTCTTTTTCCAACTATATAGGCTGTGTGTTAATTTGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 77484334 78920807 20 99.5 Internal No-hit

Features of the protein sequence	Description

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50278	100.0	MAGI2 protein [...	Homo sapiens
EAW77022	100.0	membrane associ...	Homo sapiens
EAW77024	95.6	membrane associ...	Homo sapiens
BAE27976	93.8	unnamed protein...	Mus musculus
XP_001490459	96.4	similar to Memb...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046854	1e-22	50.3	KIAA1634

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 59 140 PF00595 PDZ/DHR/GLGF

IPR008144 184 227 PF00625 Guanylate kinase

IPR001202 346 375 PF00397 WW/Rsp5/WWP

IPR001202 392 421 PF00397 WW/Rsp5/WWP

IPR001478 468 534 PF00595 PDZ/DHR/GLGF

IPR001478 681 722 PF00595 PDZ/DHR/GLGF

IPR001478 806 887 PF00595 PDZ/DHR/GLGF

IPR001478 948 1035 PF00595 PDZ/DHR/GLGF

IPR001478 1175 1254 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 68 143 SM00228 PDZ/DHR/GLGF

IPR008145 149 333 SM00072 Guanylate kinase/L-type calcium channel region

IPR001202 345 377 SM00456 WW/Rsp5/WWP

IPR001202 391 423 SM00456 WW/Rsp5/WWP

IPR001478 476 552 SM00228 PDZ/DHR/GLGF

IPR001478 655 725 SM00228 PDZ/DHR/GLGF

IPR001478 814 890 SM00228 PDZ/DHR/GLGF

IPR001478 957 1038 SM00228 PDZ/DHR/GLGF

IPR001478 1183 1257 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 59 143 PS50106 PDZ/DHR/GLGF

IPR008144 151 227 PS50052 Guanylate kinase

IPR001202 344 377 PS50020 WW/Rsp5/WWP

IPR001202 390 423 PS50020 WW/Rsp5/WWP

IPR001478 468 537 PS50106 PDZ/DHR/GLGF

IPR001478 647 710 PS50106 PDZ/DHR/GLGF

IPR001478 806 888 PS50106 PDZ/DHR/GLGF

IPR001478 948 1038 PS50106 PDZ/DHR/GLGF

IPR001478 1175 1257 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR008144 183 200 PS00856 Guanylate kinase

IPR001202 350 375 PS01159 WW/Rsp5/WWP

IPR001202 396 421 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	59	140	PF00595	PDZ/DHR/GLGF
IPR008144	184	227	PF00625	Guanylate kinase
IPR001202	346	375	PF00397	WW/Rsp5/WWP
IPR001202	392	421	PF00397	WW/Rsp5/WWP
IPR001478	468	534	PF00595	PDZ/DHR/GLGF
IPR001478	681	722	PF00595	PDZ/DHR/GLGF
IPR001478	806	887	PF00595	PDZ/DHR/GLGF
IPR001478	948	1035	PF00595	PDZ/DHR/GLGF
IPR001478	1175	1254	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	68	143	SM00228	PDZ/DHR/GLGF
IPR008145	149	333	SM00072	Guanylate kinase/L-type calcium channel region
IPR001202	345	377	SM00456	WW/Rsp5/WWP
IPR001202	391	423	SM00456	WW/Rsp5/WWP
IPR001478	476	552	SM00228	PDZ/DHR/GLGF
IPR001478	655	725	SM00228	PDZ/DHR/GLGF
IPR001478	814	890	SM00228	PDZ/DHR/GLGF
IPR001478	957	1038	SM00228	PDZ/DHR/GLGF
IPR001478	1183	1257	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	59	143	PS50106	PDZ/DHR/GLGF
IPR008144	151	227	PS50052	Guanylate kinase
IPR001202	344	377	PS50020	WW/Rsp5/WWP
IPR001202	390	423	PS50020	WW/Rsp5/WWP
IPR001478	468	537	PS50106	PDZ/DHR/GLGF
IPR001478	647	710	PS50106	PDZ/DHR/GLGF
IPR001478	806	888	PS50106	PDZ/DHR/GLGF
IPR001478	948	1038	PS50106	PDZ/DHR/GLGF
IPR001478	1175	1257	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008144	183	200	PS00856	Guanylate kinase
IPR001202	350	375	PS01159	WW/Rsp5/WWP
IPR001202	396	421	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAGCGGCCAGTTTTGTGTTGC

Primer_r
: GTACTGATCCAACCCATTCGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGCGGCCAGTTTTGTGTTGC
Primer_r	: GTACTGATCCAACCCATTCGC
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2234 bp
Genome contig ID	gi89161213r_77384334
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATATTCTAAAACACTGTCAAATAAAATATATATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATCTTTTCTTTTTCCAACTATATAGGCTGTGTGTTAATTTGAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	77484334	78920807	20	99.5	Internal No-hit

Gene/Protein Characteristic Table for KIAA0705

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information