HUGE

Gene/Protein Characteristic Table for KIAA0729

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07315
Accession No. :	AB018272
Description :	Ubiquitin carboxyl-terminal hydrolase 34.
HUGO Gene Name :
Clone Name :	hk03615 [Vector Info]
Source :	Human adult brain
Note :	Please refer to "Gene/Protein Characteristic Table for KIAA0570" because the cDNA sequence of KIAA0729 is included in KIAA0570.

Features of the cloned DNA sequence	Description

Length: 4143 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1196 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE51938	100.0	ubiquitin-speci...	Homo sapiens
Q70CQ2	100.0	Ubiquitin carbo...	Homo sapiens
EAW99998	100.0	ubiquitin speci...	Homo sapiens
XP_855134	99.0	similar to ubiq...	Canis lupus fam...
XP_613697	98.6	similar to ubiq...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011142	0	100.0	KIAA0570

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATGATATGGTGTCCTCTGTG

Primer_r
: ACCATTTATATACTGCCAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: TATGATATGGTGTCCTCTGTG
Primer_r	: ACCATTTATATACTGCCAGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0729

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information