HUGE

Gene/Protein Characteristic Table for KIAA0741

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00619
Accession No. :	AB018284
Description :	Eukaryotic translation initiation factor 5B.
HUGO Gene Name :	eukaryotic translation initiation factor 5B (EIF5B)
Clone Name :	hk04024 [Vector Info]
Flexi ORF Clone :	pF1KSDA0741
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4177 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 364 bp

Genome contig ID gi89161199f_99220300
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
ACTGATTAAATCAGTACTGCAGTATTTGATTAACC
Flanking genome sequence
(162375 - 162424)
----+----*----+----*----+----*----+----*----+----*
AAGCTTCTGCAGATTTTGTGATTCTTGGGACTTTTTTGACGTAAGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 99320300 99382673 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09828	100.0	eukaryotic tran...	synthetic construct
EAX01867	99.9	eukaryotic tran...	Homo sapiens
O60841	99.8	Eukaryotic tran...	Homo sapiens
AAH32639	99.8	Eukaryotic tran...	Homo sapiens
CAB44357	99.7	IF2 protein [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000178 823 906 PD186100 Initiation factor 2

FPrintScan IPR000795 635 648 PR00315 Protein synthesis factor

IPR000795 701 711 PR00315 Protein synthesis factor

IPR000795 717 728 PR00315 Protein synthesis factor

IPR000795 753 762 PR00315 Protein synthesis factor

HMMPfam IPR000795 631 848 PF00009 Protein synthesis factor

IPR004161 872 950 PF03144 Translation elongation factor EFTu/EF1A

HMMTigr IPR005225 631 806 TIGR00231 Small GTP-binding protein domain

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000178	823	906	PD186100	Initiation factor 2
FPrintScan	IPR000795	635	648	PR00315	Protein synthesis factor
IPR000795	701	711	PR00315	Protein synthesis factor
IPR000795	717	728	PR00315	Protein synthesis factor
IPR000795	753	762	PR00315	Protein synthesis factor
HMMPfam	IPR000795	631	848	PF00009	Protein synthesis factor
IPR004161	872	950	PF03144	Translation elongation factor EFTu/EF1A
HMMTigr	IPR005225	631	806	TIGR00231	Small GTP-binding protein domain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGACTGGCAGCTTATTGTGG

Primer_r
: CCATCAGTGTCCAAATACGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	364 bp
Genome contig ID	gi89161199f_99220300
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ACTGATTAAATCAGTACTGCAGTATTTGATTAACC
Flanking genome sequence (162375 - 162424)	----+--------+--------+--------+--------+----* AAGCTTCTGCAGATTTTGTGATTCTTGGGACTTTTTTGACGTAAGAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	99320300	99382673	24	100.0	Perfect prediction

Primer_f	: GTGACTGGCAGCTTATTGTGG
Primer_r	: CCATCAGTGTCCAAATACGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0741

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information