HUGE |
Gene/Protein Characteristic Table for KIAA0761 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00125 |
---|---|
Accession No. : | AB018304 |
Description : | Mid-1-related chloride channel 1 isoform 1. |
HUGO Gene Name : | |
Clone Name : | hk04655s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0761 |
Source : | Human adult brain |
Note : | We replaced hk04655, former representative clones for KIAA0761 with hk04655s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4696 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3039 bp Genome contig ID gi89161185r_109173653 PolyA signal sequence
(AAGAAA,-21) +----*----+----*----+----*----+----
AGCCTGATTTCTGAAAGAAATAATCTTTAAACCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTGCATAAAATTTTTCCTTTAAAATGGCTTATATAGGTATAGCTGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 109273653 109294583 11 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 551 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGTTCATCCATTCTCTTTCC | |
: GACTGAGAGATTTAACATAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTGTTCATCCATTCTCTTTCC | |
: GACTGAGAGATTTAACATAGC | |
: 197 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |