HUGE |
Gene/Protein Characteristic Table for KIAA0767 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01993 |
---|---|
Accession No. : | AB018310 |
Description : | death-inducing-protein. |
HUGO Gene Name : | GRAM domain containing 4 (GRAMD4) |
Clone Name : | aj00389 [Vector Info] |
Flexi ORF Clone : | pF1KA0767
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced hk04874, former representative clones for KIAA0767 with aj00389. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4481 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2531 bp Genome contig ID gi89161203f_45294963 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATTTTTATTTAAATAAACCTAAAATGCTTTGTGCTFlanking genome sequence
(159383 - 159432) ----+----*----+----*----+----*----+----*----+----*
AAGGCTCAGGGCTGTCTGCCTCCTTGGCAGGGCCACACGCATTGTAGGCG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 45394963 45454344 19 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 598 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACAATGGCCACACCTCTCTC | |
: AGGGACTCGAACTAAACCACC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |