HUGE

Gene/Protein Characteristic Table for KIAA0790

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06730
Accession No. :	AB018333
Description :	SAM and SH3 domain-containing protein 1.
HUGO Gene Name :	SAM and SH3 domain containing 1 (SASH1)
Clone Name :	hk05609 [Vector Info]
Flexi ORF Clone :	pF1KA0790
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518791	99.0	SAM and SH3 dom...	Pan troglodytes
CAD47811	100.0	putative adapte...	Homo sapiens
O94885	99.9	SAM and SH3 dom...	Homo sapiens
BAG72753	99.8	SAM and SH3 dom...	synthetic construct
AAH63279	99.9	SASH1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011511 630 685 PF07653 Variant SH3

IPR011510 707 769 PF07647 Sterile alpha motif homology 2

IPR011510 1246 1313 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001452 629 686 SM00326 Src homology-3

IPR001660 702 769 SM00454 Sterile alpha motif SAM

IPR001660 1246 1313 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 705 769 PS50105 Sterile alpha motif SAM

IPR001660 1249 1313 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011511	630	685	PF07653	Variant SH3
IPR011510	707	769	PF07647	Sterile alpha motif homology 2
IPR011510	1246	1313	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001452	629	686	SM00326	Src homology-3
IPR001660	702	769	SM00454	Sterile alpha motif SAM
IPR001660	1246	1313	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	705	769	PS50105	Sterile alpha motif SAM
IPR001660	1249	1313	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATTAGTGCGGTTCTCTTTGAC

Primer_r
: AGACTGGAGATAGAGCATTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATTAGTGCGGTTCTCTTTGAC
Primer_r	: AGACTGGAGATAGAGCATTCG
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0790

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information