HUGE

Gene/Protein Characteristic Table for KIAA0797

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00642
Accession No. :	AB018340
Description :	Sentrin-specific protease 6.
HUGO Gene Name :	SUMO1/sentrin specific peptidase 6 (SENP6)
Clone Name :	hk06406s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0797
Source :	Human adult brain
Note :	We replaced hk06406, former representative clones for KIAA0797 with hk06406s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 4254 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 871 bp

Genome contig ID gi89161210f_76268917
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACAGGAATTTAAATAGGAATTTACTATTTTTTTAT
Flanking genome sequence
(213986 - 214035)
----+----*----+----*----+----*----+----*----+----*
AAAGCTTTTGCTATTTTTTCATTGCTCATTTTGTTCTTATTATTTTGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 76368917 76482901 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1126 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518592	99.1	SUMO1/sentrin s...	Pan troglodytes
AAF04852	100.0	SUMO-1-specific...	Homo sapiens
Q9GZR1	99.8	Sentrin-specifi...	Homo sapiens
AAG29831	99.7	sentrin-specifi...	Homo sapiens
EAW48735	99.6	SUMO1/sentrin s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051494	1e-20	29.6	KIAA1707

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003653 680 1088 PF02902 Peptidase C48

ProfileScan IPR003653 680 1055 PS50600 Peptidase C48

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003653	680	1088	PF02902	Peptidase C48
ProfileScan	IPR003653	680	1055	PS50600	Peptidase C48

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTTCAGAAATAGGACAGTGG

Primer_r
: GTGGTACTTTTGGATTAGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	871 bp
Genome contig ID	gi89161210f_76268917
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAGGAATTTAAATAGGAATTTACTATTTTTTTAT
Flanking genome sequence (213986 - 214035)	----+--------+--------+--------+--------+----* AAAGCTTTTGCTATTTTTTCATTGCTCATTTTGTTCTTATTATTTTGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	76368917	76482901	24	99.6	Perfect prediction

Primer_f	: AGTTCAGAAATAGGACAGTGG
Primer_r	: GTGGTACTTTTGGATTAGAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0797

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information