HUGE

Gene/Protein Characteristic Table for KIAA0819

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05623
Accession No. :	AB020626
Description :	Protein MICAL-3.
HUGO Gene Name :	microtubule associated monoxygenase, calponin and LIM domain containing 3 (MICAL3)
Clone Name :	hh01037 [Vector Info]
Flexi ORF Clone :	pF1KA0819
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6049 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3079 bp

Genome contig ID gi89161203r_16550418
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGGTCTGTTTTATGCAAAATAAAAGTTTTTCAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATAGTGTGTTTCTTAAGTCATTTTACTGTATTTTTCAGGTGGATGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 16650418 16694635 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 989 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056056	99.9	microtubule ass...	Homo sapiens
EAW57777	99.9	hCG21537 [Homo ...	Homo sapiens
XP_514968	98.8	microtubule ass...	Pan troglodytes
BAG10388	96.8	MICAL-3 protein...	synthetic construct
XP_001111763	95.3	similar to Prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051455	0.00016	27.5	KIAA1668

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCCAGGCAGGTTTTCTCTCG

Primer_r
: TTCAGCCTCCAGTTTAGTCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCCAGGCAGGTTTTCTCTCG
Primer_r	: TTCAGCCTCCAGTTTAGTCAG
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3079 bp
Genome contig ID	gi89161203r_16550418
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGGTCTGTTTTATGCAAAATAAAAGTTTTTCAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAGTGTGTTTCTTAAGTCATTTTACTGTATTTTTCAGGTGGATGGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	16650418	16694635	12	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0819

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information