HUGE |
Gene/Protein Characteristic Table for KIAA0836 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05297 |
---|---|
Accession No. : | AB020643 |
Description : | D-glucuronyl C5-epimerase. |
HUGO Gene Name : | glucuronic acid epimerase (GLCE) |
Clone Name : | hj06165 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4791 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2960 bp Genome contig ID gi51511731f_67235223 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATAAAACTGTAAAATAAAGTTTTTTTCTTAAAAAGFlanking genome sequence
(116377 - 116426) ----+----*----+----*----+----*----+----*----+----*
AATATACCTGGATATTTCTCTTTCTTCTCAAATTATTCTAAGGTTATTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 67335223 67351598 3 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 609 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCATACGTCTGCTTTGTTTGC | |
: GGAAGGCAGTGTAAAACCAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |