HUGE |
Gene/Protein Characteristic Table for KIAA0839 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00651 |
---|---|
Accession No. : | AB020646 |
Description : | Rab3 GTPase-activating protein non-catalytic subunit. |
HUGO Gene Name : | RAB3 GTPase activating protein subunit 2 (non-catalytic) (RAB3GAP2) |
Clone Name : | hk04507s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0839
![]() |
Source : | Human adult brain |
Note : | We replaced hk04507, former representative clones for KIAA0839 with hk04507s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4961 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 779 bp Genome contig ID gi89161185r_218290437 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CACTGTAAAAATGTATTATCTTGTAAAACTTATGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGGCAAAGATACTAAAAATTTTAAGTCCGAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 218390437 218512302 35 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1393 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGCGTATAGAACACCCCACTC | |
: TCCTCAAGCACGGTCATCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |