HUGE |
Gene/Protein Characteristic Table for KIAA0840 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01999 |
---|---|
Accession No. : | AB020647 |
Description : | F-box/LRR-repeat protein 7. |
HUGO Gene Name : | F-box and leucine-rich repeat protein 7 (FBXL7) |
Clone Name : | hk04921s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0840
![]() |
Source : | Human adult brain |
Note : | We replaced hk04921, former representative clones for KIAA0840 with hk04921s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4562 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2605 bp Genome contig ID gi51511721f_15453305 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TAATTTACTACCAAGAAATAAAGCAATATGTTCGTFlanking genome sequence
(539597 - 539646) ----+----*----+----*----+----*----+----*----+----*
AATCAGCCTCAGCTTCATTTTTAATAACCTTTCCAGAGGAGAGTGCTGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 15553305 15992900 4 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 523 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGTTCATCCATTCTGTTCTC | |
: TAGCAGAGCCAGGAAGGAAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |