HUGE

Gene/Protein Characteristic Table for KIAA0842

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01609
Accession No. :	AB020649
Description :	pleckstrin homology domain containing, family M (with RUN domain) member 2.
HUGO Gene Name :	pleckstrin homology domain containing, family M (with RUN domain) member 2 (PLEKHM2)
Clone Name :	hk05077 [Vector Info]
Flexi ORF Clone :	pF1KSDA0842
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 833 bp

Genome contig ID gi89161185f_15783638
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTTTTTTAAAATAAAATAGACATGTTATATTGCC
Flanking genome sequence
(150213 - 150262)
----+----*----+----*----+----*----+----*----+----*
AAGGCTTGTCACTGGCCCTTTTTGAGCAGGGTAGGGGAAGGGAGCTCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 15883638 15933849 20 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1020 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH40441	100.0	PLEKHM2 protein...	Homo sapiens
Q8IWE5	100.0	Pleckstrin homo...	Homo sapiens
XP_513054	99.4	pleckstrin homo...	Pan troglodytes
XP_001089676	99.2	similar to plec...	Macaca mulatta
XP_593587	90.3	pleckstrin homo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 45 159 PF02759 RUN

IPR001849 773 874 PF00169 Pleckstrin-like

HMMSmart IPR004012 94 157 SM00593 RUN

IPR001849 773 876 SM00233 Pleckstrin-like

ProfileScan IPR004012 37 159 PS50826 RUN

IPR001849 772 874 PS50003 Pleckstrin-like

ScanRegExp IPR002086 820 831 PS00070 Aldehyde dehydrogenase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	45	159	PF02759	RUN
IPR001849	773	874	PF00169	Pleckstrin-like
HMMSmart	IPR004012	94	157	SM00593	RUN
IPR001849	773	876	SM00233	Pleckstrin-like
ProfileScan	IPR004012	37	159	PS50826	RUN
IPR001849	772	874	PS50003	Pleckstrin-like
ScanRegExp	IPR002086	820	831	PS00070	Aldehyde dehydrogenase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTAGCACCGAGGAGCAAAGG

Primer_r
: GGCTCTTGACGAAACTCTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTAGCACCGAGGAGCAAAGG
Primer_r	: GGCTCTTGACGAAACTCTAGG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	833 bp
Genome contig ID	gi89161185f_15783638
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTTTTTTAAAATAAAATAGACATGTTATATTGCC
Flanking genome sequence (150213 - 150262)	----+--------+--------+--------+--------+----* AAGGCTTGTCACTGGCCCTTTTTGAGCAGGGTAGGGGAAGGGAGCTCTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	15883638	15933849	20	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0842

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information