| HUGE |
Gene/Protein Characteristic Table for KIAA0854 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00659 |
|---|---|
| Accession No. : | AB020661 |
| Description : | Zinc fingers and homeoboxes protein 2. |
| HUGO Gene Name : | zinc fingers and homeoboxes 2 (ZHX2) |
| Clone Name : | hk06169 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0854
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4089 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1271 bp Genome contig ID gi51511724f_123844895 PolyA signal sequence
(AATAAA,-27)
TGTAACTCAATAAAGCAAAGACTAAACATTTTTATFlanking genome sequence
(211036 - 211085)
AACCTTTTCCTCTACTTCGCCTTCTTTATTGTCGTCTGGCTCCCGAGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 123944888 124055929 3 98.9 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 868 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : CACCTTTCTAAATACCAGCAG | |
| : TACCACACCGAGAAAAGGCAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 8 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
